Skip to Content
Merck
All Photos(1)

Key Documents

EHU001471

Sigma-Aldrich

MISSION® esiRNA

targeting human AURKB

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCTTAACGCGGCACTTCACAATTGATGACTTTGAGATTGGGCGTCCTCTGGGCAAAGGCAAGTTTGGAAACGTGTACTTGGCTCGGGAGAAGAAAAGCCATTTCATCGTGGCGCTCAAGGTCCTCTTCAAGTCCCAGATAGAGAAGGAGGGCGTGGAGCATCAGCTGCGCAGAGAGATCGAAATCCAGGCCCACCTGCACCATCCCAACATCCTGCGTCTCTACAACTATTTTTATGACCGGAGGAGGATCTACTTGATTCTAGAGTATGCCCCCCGCGGGGAGCTCTACAAGGAGCTGCAGAAGAGCTGCACATTTGACGAGCAGCGAACAGCCACGATCATGGAGGAGTTGGCAGATGCTCTAATGTACTGCCATGGGAAGAAGGTGATTCACAGAGACATAAAGCCAGAAAATCTGCTCTTAGGGCTCAAGGGAGAGCTGAAGATTGCTGACTTCGGCTGGTCTGTGCATGCGCCCTCCCTGAGGAGGAAGACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAGGGGCGCATGCACAATGAGAAGGTGGATCTGTGGTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sun Lee et al.
Pathology oncology research : POR, 26(1), 453-459 (2018-11-14)
NOP53 ribosome biogenesis factor (NOP53) is a nucleolar protein involved in oncogenesis/tumor suppression, cell cycle regulation, and cell death. Here, we investigated the role of NOP53 in the maintenance of normal nuclear shape and chromosomal stability. Depletion of NOP53 by
Kazuharu Kai et al.
Molecular cancer therapeutics, 14(12), 2687-2699 (2015-10-08)
Currently, no targeted drug is available for triple-negative breast cancer (TNBC), an aggressive breast cancer that does not express estrogen receptor, progesterone receptor, or HER2. TNBC has high mitotic activity, and, because Aurora A and B mitotic kinases drive cell
Antonio Madejón et al.
Journal of hepatology, 63(2), 312-319 (2015-03-04)
Chronic hepatitis C is a leading cause of chronic liver disease, cirrhosis and hepatocellular carcinoma. DNA methylation and histone covalent modifications constitute crucial mechanisms of genomic instability in human disease, including liver fibrosis and hepatocellular carcinoma. The present work studies
Aarthi Jayanthan et al.
Journal of pediatric hematology/oncology, 41(6), e359-e370 (2019-02-01)
Recent studies have shown that cell cycle events are tightly controlled by complex and shared activities of a select group of kinases. Among these, polo-like kinases (Plks) are regulatory mitotic proteins that are overexpressed in several types of cancer and
Zhibin Yu et al.
Journal of hematology & oncology, 10(1), 115-115 (2017-06-10)
SIX homeobox 3 (SIX3) is a member of the sine oculis homeobox transcription factor family. It plays a vital role in the nervous system development. Our previous study showed that the SIX3 gene is hypermethylated, and its expression is decreased

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service