Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU013931

Sigma-Aldrich

MISSION® esiRNA

targeting human BMP2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTCAGCAGAGCTTCAGGTTTTCCGAGAACAGATGCAAGATGCTTTAGGAAACAATAGCAGTTTCCATCACCGAATTAATATTTATGAAATCATAAAACCTGCAACAGCCAACTCGAAATTCCCCGTGACCAGACTTTTGGACACCAGGTTGGTGAATCAGAATGCAAGCAGGTGGGAAAGTTTTGATGTCACCCCCGCTGTGATGCGGTGGACTGCACAGGGACACGCCAACCATGGATTCGTGGTGGAAGTGGCCCACTTGGAGGAGAAACAAGGTGTCTCCAAGAGACATGTTAGGATAAGCAGGTCTTTGCACCAAGATGAACACAGCTGGTCACAGATAAGGCCATTGCTAGTAACTTTTGGCCATGATGGAAAAGGGCATCCTCTCCACAAAAGAGAAAAACGTCAAGCCAAACACAAACAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sarah Ouahoud et al.
Oncogene, 39(12), 2453-2466 (2020-01-25)
Patients with the mesenchymal subtype colorectal cancer (CRC) have a poor prognosis, in particular patients with stroma-rich tumors and aberrant SMAD4 expression. We hypothesized that interactions between SMAD4-deficient CRC cells and cancer-associated fibroblasts provide a biological explanation. In transwell invasion
Weijie Yang et al.
Journal of cellular biochemistry, 120(12), 19684-19690 (2019-08-23)
miR-129-5p is implicated in many diseases, such as laryngeal cancer and breast cancer. In this study, we studied the mechanism underlying the role of BMP2 in intervertebral disc degeneration (IDD). We used a luciferase assay system to determine the relationship
Long Yu et al.
Biochemical and biophysical research communications, 516(2), 546-550 (2019-06-27)
Circular RNAs (circRNAs) are emerging as important regulators in human disease. The expression profile and mechanism of circRNAs in postmenopausal osteoporosis remains largely unknown. Bone morphogenetic protein 2 (BMP2) is known to play important role in inducing osteogenic differentiation. MiR-98
Wei Wang et al.
Molecular pain, 15, 1744806918824250-1744806918824250 (2019-02-26)
Bone cancer pain is one of the most severe and intractable complications in patients suffering from primary or metastatic bone cancer and profoundly compromises the quality of life. Emerging evidence indicates that the dorsal root ganglion play an integral role
Vahid Kheirollahi et al.
Nature communications, 10(1), 2987-2987 (2019-07-07)
Idiopathic pulmonary fibrosis (IPF) is a fatal disease in which the intricate alveolar network of the lung is progressively replaced by fibrotic scars. Myofibroblasts are the effector cells that excessively deposit extracellular matrix proteins thus compromising lung structure and function.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service