Skip to Content
Merck
All Photos(1)

Key Documents

EHU081661

Sigma-Aldrich

MISSION® esiRNA

targeting human NTRK1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCTGCCTCTTCCTTTCTACGCTGCTCCTTGTGCTCAACAAATGTGGACGGAGAAACAAGTTTGGGATCAACCGCCCGGCTGTGCTGGCTCCAGAGGATGGGCTGGCCATGTCCCTGCATTTCATGACATTGGGTGGCAGCTCCCTGTCCCCCACCGAGGGCAAAGGCTCTGGGCTCCAAGGCCACATCATCGAGAACCCACAATACTTCAGTGATGCCTGTGTTCACCACATCAAGCGCCGGGACATCGTGCTCAAGTGGGAGCTGGGGGAGGGCGCCTTTGGGAAGGTCTTCCTTGCTGAGTGCCACAACCTCCTGCCTGAGCAGGACAAGATGCTGGTGGCTGTCAAGGCACTGAAGGAGGCGTCCGAGAGTGCTCGGCAGGACTTCCAGCGTGAGGCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wenyu Shi et al.
Molecular oncology, 11(9), 1189-1207 (2017-05-31)
Nucleophosmin-anaplastic lymphoma kinase-expressing (NPM-ALK
Marzia Di Donato et al.
Cancers, 11(6) (2019-06-09)
Resistance to hormone therapy and disease progression is the major challenge in clinical management of prostate cancer (PC). Drugs currently used in PC therapy initially show a potent antitumor effects, but PC gradually develops resistance, relapses and spreads. Most patients
Sam Faulkner et al.
The American journal of pathology, 188(1), 229-241 (2017-10-19)
Neurotrophin receptors are emerging targets in oncology, but their clinicopathologic significance in thyroid cancer is unclear. In this study, the neurotrophin tyrosine receptor kinase TrkA (also called NTRK1), the common neurotrophin receptor p75NTR, and the proneurotrophin receptor sortilin were analyzed
Xinyuan Yang et al.
Oncogene, 38(15), 2778-2787 (2018-12-14)
Multiple cancer signalling networks take part in regulatory crosstalks with the Hippo tumour suppressor pathway through the transcriptional cofactor Yes-associated protein (YAP). Nevertheless, how YAP is controlled by pathway crosstalks in tumourigenesis remains poorly understood. Here, we performed a targeted
M Rochman et al.
Mucosal immunology, 8(4), 785-798 (2014-11-13)
Although interleukin (IL)-13 and neurotrophins are functionally important for the pathogenesis of immune responses, the interaction of these pathways has not been explored. Herein, by interrogating IL-13-induced responses in human epithelial cells we show that neurotrophic tyrosine kinase receptor, type

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service