Skip to Content
Merck
All Photos(1)

Key Documents

EHU021061

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX9

Sign Into View Organizational & Contract Pricing

Select a Size


Select a Size

Change View

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCAAGACGGAGCAGCTGAGCCCCAGCCACTACAGCGAGCAGCAGCAGCACTCGCCCCAACAGATCGCCTACAGCCCCTTCAACCTCCCACACTACAGCCCCTCCTACCCGCCCATCACCCGCTCACAGTACGACTACACCGACCACCAGAACTCCAGCTCCTACTACAGCCACGCGGCAGGCCAGGGCACCGGCCTCTACTCCACCTTCACCTACATGAACCCCGCTCAGCGCCCCATGTACACCCCCATCGCCGACACCTCTGGGGTCCCTTCCATCCCGCAGACCCACAGCCCCCAGCACTGGGAACAACCCGTCTACACACAGCTCACTCGACCTTGAGGAGGCCTCCCACGAAGGGCGAAGATGGCCGAGATGATCCTAAAAATAACCGAAGAAAGAGAGGACCAACCAGAATTCCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Haiyun Luo et al.
Journal of endodontics, 44(5), 792-799 (2018-03-25)
The process of pulpitis is characterized by extracellular matrix imbalance and inflammatory cell infiltration. As an essential transcription factor, sex-determining region Y-box 9 (SOX9) is significantly inhibited by tumor necrosis factor alpha in inflammatory joint diseases. The aim of this
Jing Wang et al.
Oncotarget, 8(1), 574-582 (2016-11-24)
Cisplatin-based chemotherapy is the most commonly used treatment regimen for gastric cancer (GC), however, the resistance to cisplatin represents the key limitation for the therapeutic efficacy. Aberrant expression of MiR-524-5p appears to be involves in tumorigenesis and chemoresistance. However, the
Xiuyu Wang et al.
Biochemical and biophysical research communications, 516(1), 236-244 (2019-06-22)
The malignant proliferation is one of the major characteristic for tumor cells, however the mechanism of lung cancer cells uncontrollable proliferation is still confusing. This study investigated the mechanism of up-regulated FOXA1 in lung cancer and its tumorigenic function in
C-Q Liu et al.
European review for medical and pharmacological sciences, 23(13), 5628-5639 (2019-07-13)
The aim of the current study was to investigate the potential roles of miR-215-3p in the progression of cervical cancer. The levels of miR-215-3p in both cervical cancer tissues and cell lines were detected using quantitative Real-time polymerase chain reaction
J-C Shang et al.
European review for medical and pharmacological sciences, 23(14), 6160-6169 (2019-08-01)
Gastric cancer is one of the most common gastrointestinal malignancy, which is often diagnosed at an advanced stage. MicroRNA-105 (miR-105) was downregulated and acts as a tumor suppressor in various cancers. The purpose of this study was to explore the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service